Friday, September 18, 2026

Conspiracy Resource

Conspiracy news & views from all angles, up-to-the-minute and uncensored

COVID-19

Worst Fears Realized: Pfizer mRNA Transcribes into DNA

Guest Post By Igor Chudov

mRNA Vaccines Actually are “Gene Therapy”, Study Shows

A new study is out: Intracellular Reverse Transcription of Pfizer BioNTech COVID-19 mRNA Vaccine BNT162b2 In Vitro in Human Liver Cell Line.

What it is saying is: lab studies show that mRNA vaccine DOES integrate itself into human cellular DNA. This means that a shot of Pfizer vaccine, taken even once, permanently changes the DNA of affected cells.

For over a year, our trusted “health experts and fact checkers” kept telling us the opposite:

However, the bombshell article from Current Issues of Molecular Biology shows the opposite.

What the article shows is that in vitro, using a human liver cell line, Pfizer mRNA vaccine uses a natural reverse transcriptase enzyme called LINE-1, and the genetic code of the vaccine is reverse transcribed into the DNA.

It also explains that vaccine mRNA actually does travel to the liver as one of the preferred sites (the other sites, as we heard, are ovaries and more).

What does it mean? Normally, our cells do the opposite: the cell nucleus, where the DNA is, expresses certain DNA code based on conditions of the cell, and produces natural, human messenger RNA. That messenger RNA travels out of the nucleus, where it is expressed into proteins needed for cell building. This is how growing organisms express different genetic programs to grow muscle cells or brain cells, etc.

This process is called “transcription”.

For many years, Central Dogma of Molecular Biology stated that the “reverse transcription” — moving genetic code from RNA back into the sacred cellular nucleus and recoding the DNA — was impossible. Eventually, scientists realized that it is possible under various conditions. For example, the HIV RNA virus is able to do so and it reprograms our DNA to produce copies of it. HIV is the virus that causes AIDS.

To effect reverse transcription, enzymes called “reverse transcriptases” are needed. One of them is called LINE-1.

Apparently, per study, the Pfizer mRNA vaccine causes cells to produce that LINE-1 enzyme.

After seeing LINE-1 reverse transcriptase rise, they tested for alterations to the DNA, making sure they are not picking up the RNA instead.

The genetic code that they picked up is:

CGAGGTGGCCAAGAATCTGAACGAGA
GCCTGATCGACCTGCAAGAACTGGGGAAGT ACGAGCAGTACATCAAGTGGCCCTGGTACA
TCTGGCTGGGCTTTATCGCCGGACTGATTG CCATCGTGATGGTCACAATCATGCTGTGTT
GCATGACCAGCTGCTGTAGCTGCCTGAAGG GCTGTTGTAGCTGTGGCAGCTGCTGCAAGT
TCGACGAGGACGATTCTGAGCCCGTGCTGA
AGGGCGTGAAACTGCACTACACATGATGAC
TCGAGCTGGTACTGCATGCACGCAATGCTA GCTGCCCCTTTCCCGTCCTGGGTACCCCGA
GTCTCCCCCGACCTCGGGTCCCAGGTATGC TCCCACCTCCACCTGCCCCACTCACCACCT
CTGCTAGTTCCAGACACCTCCCAAGCACGC AGCAATGCAGCTCAAAACGCTTAGCCTA

Anyone wants to run BLAST on it?

Simplified

As I explained in response to a questioner:

Pfizer mRNA vaccine changes our genetic code that determines how our organisms operate, that you inherited from your mom and dad. Now your DNA was changed from what your mom and dad gave you, by adding a little mysterious “edit” from Pfizer.
Your organism acts in accordance with your DNA program, and now, well, the program has been hacked and modified by Pfizer.

Cancer Code

Considering that Sars-Cov-2 “spike protein” has cancer code from Moderna 2017’ patent 9,587,003, it is imperative to find out the implications of this reverse transcription, and whether the vaccinated now have any undesirable genetic code embedded into their DNA.

Of particular interest is whether this mRNA-induced reverse transcription affects the “germ line”, such as eggs and sperm cells, and whether it also affects the fetus of pregnant mothers.

—————————————————–
The corrupt establishment will do anything to suppress sites like the Burning Platform from revealing the truth. The corporate media does this by demonetizing sites like mine by blackballing the site from advertising revenue. If you get value from this site, please keep it running with a donation. [Burning Platform LLC – PO Box 1520 Kulpsville, PA 19443] or Paypal

***
This article has been archived by Conspiracy Resource for your research. The original version from The Burning Platform can be found here.